MCP server/ai-tools

Bio-MCP-Evo2 MCP Server

MCP server for evo2 DNA language model

bio-mcp/bio-mcp-evo2 ↗by bio-mcpupdated
1

Add it to Claude Code

claude mcp add -e "BIO_MCP_EVO2_EXECUTION_MODE=${BIO_MCP_EVO2_EXECUTION_MODE}" bio-mcp-evo2 -- python -m src.server
Required:BIO_MCP_EVO2_EXECUTION_MODE+ 2 optional
2

Make your agent remember this setup

bio-mcp-evo2's config, env vars, and the gotchas you hit — recalled in every future Claude Code, Cursor, and Codex session.

npx conare@latest

Free · one command · indexes the sessions already on disk. Set up in the browser instead →

What it does

  • Generate DNA sequences with specified properties
  • Score sequence likelihoods and calculate perplexity
  • Extract learned representations for downstream biological tasks
  • Predict variant effects on biological function
  • Support for multiple execution modes including local GPU, SLURM, and Nvidia NIM API

Tools 4

evo2_generateGenerate DNA sequences from a prompt.
evo2_scoreCalculate sequence perplexity or get raw logits.
evo2_embedExtract learned representations from sequences.
evo2_variant_effectPredict the effect of mutations.

Environment Variables

BIO_MCP_EVO2_EXECUTION_MODErequiredExecution mode selection (local, sbatch, singularity, docker, api)
BIO_MCP_EVO2_NIM_API_KEYAPI key for Nvidia NIM cloud API
BIO_MCP_EVO2_MODEL_SIZEModel size (7b, 40b)

Try it

Generate a 200bp DNA sequence that could function as a promoter.
Calculate the perplexity score for the following DNA sequence: ATCGATCGATCGATCGATCG.
Extract the learned representation for this sequence at layer blocks.28.mlp.l3.
Predict the variant effect of changing the reference sequence ATCGATCG to ATCGATCA.
Original README from bio-mcp/bio-mcp-evo2

bio-mcp-evo2

MCP server for evo2 DNA language model - enabling AI assistants to generate and analyze DNA sequences using state-of-the-art genomic foundation models.

Overview

evo2 is a genomic foundation model capable of:

  • Generating DNA sequences with specified properties
  • Scoring sequence likelihoods and calculating perplexity
  • Extracting learned representations for downstream tasks
  • Predicting variant effects on biological function

This MCP server provides multiple execution modes to support various computational environments:

  • Local: Direct GPU execution (requires H100 or compatible GPU)
  • SBATCH: Submit jobs to SLURM clusters
  • Singularity/Docker: Container-based execution
  • API: Nvidia NIM cloud API (no local GPU required)

Installation

Local Installation

git clone https://github.com/bio-mcp/bio-mcp-evo2.git
cd bio-mcp-evo2
pip install -e .[dev]

Container Installation

Docker
docker build -t bio-mcp-evo2 .
docker run --gpus all bio-mcp-evo2
Singularity (HPC)
singularity build --fakeroot evo2.sif Singularity.def
singularity run --nv evo2.sif

Configuration

Environment Variables

# Execution mode selection
export BIO_MCP_EVO2_EXECUTION_MODE=api  # Options: local, sbatch, singularity, docker, api

# Model configuration
export BIO_MCP_EVO2_MODEL_SIZE=7b  # Options: 7b, 40b
export BIO_MCP_EVO2_CUDA_DEVICE=0

# API configuration (for API mode)
export BIO_MCP_EVO2_NIM_API_KEY=your-api-key

# SBATCH configuration (for HPC clusters)
export BIO_MCP_EVO2_SBATCH_PARTITION=gpu
export BIO_MCP_EVO2_SBATCH_TIME=01:00:00
export BIO_MCP_EVO2_SBATCH_MEMORY=64G
export BIO_MCP_EVO2_SBATCH_GPU_TYPE=h100

Claude Desktop Integration

Add to your claude_desktop_config.json:

{
  "mcpServers": {
    "bio-evo2": {
      "command": "python",
      "args": ["-m", "src.server"],
      "cwd": "/path/to/bio-mcp-evo2",
      "env": {
        "BIO_MCP_EVO2_EXECUTION_MODE": "api",
        "BIO_MCP_EVO2_NIM_API_KEY": "your-api-key"
      }
    }
  }
}

For HPC with Singularity:

{
  "mcpServers": {
    "bio-evo2": {
      "command": "singularity",
      "args": ["run", "--nv", "/path/to/evo2.sif"],
      "env": {
        "BIO_MCP_EVO2_EXECUTION_MODE": "local"
      }
    }
  }
}

Available Tools

evo2_generate

Generate DNA sequences from a prompt.

# Example usage
result = await evo2_generate({
    "prompt": "ATCGATCGATCG",
    "n_tokens": 100,
    "temperature": 1.0,
    "top_k": 4
})

evo2_score

Calculate sequence perplexity or get raw logits.

# Example usage
result = await evo2_score({
    "sequence": "ATCGATCGATCGATCGATCG",
    "return_logits": False
})

evo2_embed

Extract learned representations from sequences.

# Example usage
result = await evo2_embed({
    "sequence": "ATCGATCGATCGATCGATCG",
    "layer": "blocks.28.mlp.l3"
})

evo2_variant_effect

Predict the effect of mutations.

# Example usage
result = await evo2_variant_effect({
    "reference_sequence": "ATCGATCGATCGATCGATCG",
    "variant_sequence": "ATCGATCGATCGATCAATCG",
    "context_window": 1000
})

Execution Modes

API Mode (Recommended for Getting Started)

No GPU required. Uses Nvidia's hosted API.

export BIO_MCP_EVO2_EXECUTION_MODE=api
export BIO_MCP_EVO2_NIM_API_KEY=your-key
python -m src.server

Local Mode

Requires H100 GPU with sufficient memory.

export BIO_MCP_EVO2_EXECUTION_MODE=local
python -m src.server

SBATCH Mode

For HPC clusters with SLURM.

export BIO_MCP_EVO2_EXECUTION_MODE=sbatch
export BIO_MCP_EVO2_SBATCH_PARTITION=gpu
python -m src.server

Container Modes

For isolated execution environments.

# Docker
export BIO_MCP_EVO2_EXECUTION_MODE=docker
docker run --gpus all -v $PWD:/workspace bio-mcp-evo2

# Singularity
export BIO_MCP_EVO2_EXECUTION_MODE=singularity
singularity run --nv evo2.sif

Examples

Generate a promoter sequence

User: Generate a 200bp DNA sequence that could function as a promoter

Frequently Asked Questions

What are the key features of Bio-MCP-Evo2?

Generate DNA sequences with specified properties. Score sequence likelihoods and calculate perplexity. Extract learned representations for downstream biological tasks. Predict variant effects on biological function. Support for multiple execution modes including local GPU, SLURM, and Nvidia NIM API.

What can I use Bio-MCP-Evo2 for?

Designing synthetic promoter sequences for gene expression studies. Analyzing the impact of specific genetic mutations on biological function. Extracting sequence embeddings for downstream machine learning classification tasks. Evaluating the likelihood of specific DNA sequences using genomic foundation models.

How do I install Bio-MCP-Evo2?

Install Bio-MCP-Evo2 by running: pip install -e .[dev]

What MCP clients work with Bio-MCP-Evo2?

Bio-MCP-Evo2 works with any MCP-compatible client including Claude Desktop, Claude Code, Cursor, and other editors with MCP support.

Conare · memory for coding agents

Turn this server into reusable context

Keep Bio-MCP-Evo2 docs, env vars, and workflow notes in Conare so your agent carries them across sessions.

Set up free$npx conare@latest