Add it to Claude Code
claude mcp add sequence-simulation -- node dist/server.jsMake your agent remember this setup
sequence-simulation's config, env vars, and the gotchas you hit — recalled in every future Claude Code, Cursor, and Codex session.
npx conare@latestFree · one command · indexes the sessions already on disk. Set up in the browser instead →
What it does
- DNA sequence generation with GC content and Markov chain models
- NGS read simulation supporting Illumina, 454, Ion Torrent, and PacBio models
- Protein sequence generation with hydrophobic or disorder-prone biases
- Evolutionary simulation including population evolution and selection pressure
- Phylogenetic tree-based sequence evolution with multiple substitution models
Tools 3
Generate DNA SequenceGenerate random DNA sequences with various models.Generate Protein SequenceGenerate random protein sequences with various biases.Simulate FASTQ FileSimulate FASTQ sequencing reads with realistic quality scores and error models.Try it
Original README from coreymhudson/mcp-sequence-simulation
MCP Sequence Simulation Server
An MCP (Model Context Protocol) server for simulating DNA and amino acid sequences using various evolutionary models and algorithms. This server provides powerful tools for sequence generation, mutation simulation, evolutionary modeling, and phylogenetic analysis.
Features
🧬 DNA Sequence Generation
- Random DNA Generation: Generate sequences with specified GC content
- Markov Chain Models: Context-dependent sequence generation
- Codon-Biased Generation: Realistic protein-coding sequences
- Customizable Parameters: Length, GC content, seed for reproducibility
📊 FASTQ Sequencing Simulation
- NGS Read Simulation: Generate realistic next-generation sequencing reads
- Platform-Specific Models: Illumina, 454, Ion Torrent, and PacBio quality models
- Paired-End Support: Both single-end and paired-end sequencing reads
- Error Modeling: Configurable sequencing error rates with realistic quality scores
- Coverage Control: Generate reads to achieve specified coverage depths
- NEAT-Based: Implementation inspired by published NEAT methodology
🧭 Protein Sequence Generation
- Random Protein Generation: Uniform amino acid distribution
- Hydrophobic-Biased: Membrane protein-like sequences
- Disorder-Prone: Intrinsically disordered protein sequences
- Custom Composition: User-defined amino acid frequencies
🔬 Sequence Mutation
- Substitution Mutations: Point mutations with transition/transversion bias
- Insertion/Deletion Events: Indel mutations
- Multiple Iterations: Track changes over time
- Both DNA and Protein: Support for nucleotide and amino acid sequences
🌳 Evolutionary Simulation
- Population Evolution: Simulate populations over generations
- Selection Pressure: Configurable fitness functions
- Lineage Tracking: Follow individual evolutionary paths
- Fitness Functions: GC content, length, hydrophobicity targets
🌲 Phylogenetic Simulation
- Tree-Based Evolution: Simulate sequences on phylogenetic trees
- Multiple Substitution Models: JC69, K80, HKY85, GTR
- Molecular Clock: Uniform or variable evolutionary rates
- Multiple Output Formats: FASTA, NEXUS, PHYLIP
Installation
npm install
npm run build
Usage
With Claude Code
./start-claude.sh
Manual Configuration
Add to your Claude Code MCP configuration:
{
"mcpServers": {
"sequence-simulation": {
"command": "node",
"args": ["dist/server.js"],
"cwd": "/path/to/mcp-sequence-simulation"
}
}
}
Available Tools
1. Generate DNA Sequence
Generate random DNA sequences with various models.
Parameters:
length(required): Sequence lengthgcContent(optional): GC content ratio (0-1, default: 0.5)count(optional): Number of sequences (default: 1)model(optional): "random", "markov", or "codon-biased"seed(optional): Random seed for reproducibilityoutputFormat(optional): "fasta" or "plain"
Example:
{
"length": 1000,
"gcContent": 0.6,
"count": 5,
"model": "markov",
"outputFormat": "fasta"
}
2. Generate Protein Sequence
Generate random protein sequences with various biases.
Parameters:
length(required): Sequence lengthcount(optional): Number of sequences (default: 1)model(optional): "random", "hydrophobic-bias", or "disorder-prone"composition(optional): Custom amino acid frequenciesseed(optional): Random seedoutputFormat(optional): "fasta" or "plain"
Example:
{
"length": 200,
"count": 3,
"model": "hydrophobic-bias",
"outputFormat": "fasta"
}
3. Simulate FASTQ File
Simulate FASTQ sequencing reads with realistic quality scores and error models.
Parameters:
referenceSequence(required): Reference DNA sequence to generate reads fromreadLength(required): Length of each sequencing read (50-300 bp)coverage(required): Target sequencing coverage depth (1-1000x)readType(optional): "single-end" or "paired-end" (default: "single-end")insertSize(optional): Mean insert size for paired-end reads (default: 300)insertSizeStd(optional): Standard deviation of insert size (default: 50)errorRate(optional): Base calling error rate 0-0.1 (default: 0.01)qualityModel(optional): "illumina", "454", "ion-torrent", or "pacbio" (default: "illumina")mutationRate(optional): Rate of true mutations 0-0.05 (default: 0.001)seed(optional): Random seed for reproducibilityoutputFormat(optional): "fastq" or "json" (default: "fastq")
Example:
{
"referenceSequence": "ATCGATCGATCGATCGATCGATCGATCGATCGATCG",
"readLength": 150,
"coverage": 30,
"readType": "paired-end",
"errorRate": 0.01,
"qualityModel": "illumina"
}
Citation: Based on Stephens et al. (2016) PLOS ONE 11(11): e0167047.
4. Mutate Sequence
Apply mutations to exist